blastn
sporte | March 7, 2008Here's a fun puzzler for you to figure out.
The blast graph is here:
The table with scores is here, click the table to see a bigger image:
And here is the puzzling part: Why is the total score so high?
If you want to repeat this for yourself, go here.
You can use this sequence as a query (it's the same one that I used).
>301.ab1
CTAGCTCTTGGGTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCCGATGGAG
GGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGTGGGGGA
CCTTCGGGCCTCACACCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGG
CTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGA…
sporte | February 12, 2008yep, I've become a videoblogger, at least sometimes.
See the first video below. Be kind in the comments, this is a new thing for me.
This video introduces the different blast programs, discusses word size, and how blastn works, the blastn score and the E value. The treatment is light and not too in depth, but as I said, it's an introduction.
A quick introduction to BLAST from Sandra Porter on Vimeo.