apalazzo
Posts by this author
August 25, 2006
This week it's an easy one.
Click here for a blowup.
Hint:The debate stems from work done here.
What the hell am I talking about? You tell me.
(P.S. Ignore the arrow.)
August 24, 2006
OK this post was a warm up for today.
Microtubules are long hollow polymers. They are also polar. Their minus ends are inert and are found towards the cell center while their plus ends grow and shrink and are found towards the cell periphery.
Question: Why are microtubules hollow?
Well you might…
August 24, 2006
Just an update for those who know me. This past week has been a little crazy. We just bought our first car (my wife needs it for her new job). Having lived close to 10 years in Manhattan and then downtown Boston, we never really needed a car and probably saved quite a bit by never owning one. But I…
August 22, 2006
The Cytoskeleton. Now that's what you call a misnomer. It is one of the most fascinating, yet misunderstood, macromolecular assemblies of the cell. Yes, the cytoskeleton can act as a scafold onto which the rest of the cell is drapped (so to speak), but in reality the cytoskeleton is a dynamic…
August 20, 2006
What decade are we in? I've always wondered, are we the in the Zeros'?
The study of Biology is a cross between Occam's Razor and Murphy's Laws.
"I don't believe in evolution" is like saying "I don't believe in algebra".
Evolution is like the free market, intelligent design is communism.
(PS…
August 19, 2006
Not so long ago I wrote about piRNA. After reading a bit more, there are some points I'd like to make:
- It would seem that piRNA (read this for background) are required for proper spermiogenesis.
- The argonaute family members associated with piRNA (Piwi, Miwi, Mili, Riwi ...) are only expressed…
August 18, 2006
So look what I saw:
Yes this current issue.
Midway down, you'll bump into this paragraph:
Yeah I know mostly frivolous stuff. It kinda pisses me off that its always the S&S entries that get lots of comments and the really neat and cool stories like my centrosome endosymbiotic theory entry…
August 18, 2006
In celebration of the 11th edition (and because I enjoy presenting my hints in doublets) I present this week's mystery campus as a dialogue. Have fun:
X: [thinking to himself] Going out during evenings ... lovely.
I: Hello X, what a coincidence, I came out for a nice brisk stroll and I saw you…
August 17, 2006
Wow, centrosomes attract a strange crowd.
Strange theories about centrosomes are plentiful. Some quacks have claimed that they are , "the eyes of the cell", some sort of quantum pulse generator that secretes consciousness and now a turbine.
Ian Musgrave at Panda's thumb posted a summary of how ID…
August 17, 2006
Everyone is all up in arms about whether Pluto (+ other massive objects at the far end of our solar system) is a planet. It would seem like every ScienceBlog blogger expounded his/her opinion on the subject.
I thought this would be a one day affair in our ADD world, but again this morning I pick up…
August 16, 2006
(in the best possible way)
I'm scanning through Science when BAM:
He's imaging RNA polymerase as it transcribes DNA .... nucleotide by freakin' nucleotide ... it's sequencing at the individual molecule level.
(To all those thinking about the future of biology and day dreaming of "big biology",…
August 16, 2006
Yes I wrote about centrosome kissing and then ... another paper appears in Nature Cell Biology.
But this time it's not in mammalian cells but in yeast. Remember what I once said:
prokaryotic (bacterial) strategy: out-multiply your neighborseukaryotic strategy: out-sophisticate your neighborsyeast…
August 14, 2006
GpppGACUCAUAUUUCUAUUUCAUGUCGUGCUCCUAGCCGCCAUGGCUAAUUA
UAUGGCUUAUCAUGCUGUUGAAUCUGAAGAAAAUACUCAUAUUUCUCAUGA
ACGUGAAAUCAGGUAGGCAUCACACACGAUUAACAACCCCUAAAAAUACA
CUUUGAAAAUAUUGAAAAUAUGUUUUUGUAUACAUUUUUGAUAUUUUCAAACA
AUACGCAGUUAUAAAACUCAUUAGCUAACCCAUUUUUUUCUUUGCUUAUGCUUA…
August 12, 2006
A new paper provides evidence that certain RNAs associate with centrosomes and may represent a centrosomal RNA genome. Furthermore this potential genome includes an enzyme that could copy the centrosomal associated RNA. But first some background.
For many years, there have been scientists…
August 11, 2006
Can it be? Number ten?
OK time for a real challenge. Here is a little twist, I'll present two aerial photos, and you tell me
what is the connection?
(that's a big hint)
View larger photo
View larger photo
Leave your answers in the comments section.
August 10, 2006
This has to be one of the funniest/strangest blogs:blog.tenderbutton.com
He recently performed NMR and TLC on his earwax.
I love his rant on old crappy bottles of reagents. (Great graphics too!)
And his love for dirt cheap reagents with antiquated warning lables.
I really like this TBSCl, mainly…
August 10, 2006
Others write about it.
So apparently some rant by a Physicist has been making the rounds (and it's not the first time). Lots of bloggers have commented on it.
Should students be discouraged from going into science? Do we have to many PhDs? Should we help science undergrads organize their careers?…
August 9, 2006
In the world of science blogging, it would seem, that there ain't many cell biologists (as far as I can tell). What is a Cell Biologist? Well lets just say that one of the main tools of your trade is photographing fluorescent images of cells.
Here is another definition (from the Disciplines of the…
August 9, 2006
I got this funny/cynical email from a good friend. What do you think?
In the jungle of research, a small white rabbit stumbles upon a wolf.
"What's a bunny doing here? " says the famished wolf.
"I am doing an important piece of research work for my thesis, " says the rabbit.
"And what is that?"
"It…
August 8, 2006
There is a paper in last week's Science that describes a proofreading mechanism in prokaryotic (i.e. bacterial) RNA Polymerase, the enzyme responsible for transcribing DNA into RNA. When RNA Pol incorporates the wrong base into a growing RNA, the enzyme moves two steps back and cleaves the…
August 8, 2006
A paper from a week or so, describes a method for detecting regions in the genome where DNA wrapping takes place. So what (you may asked) is DNA wrapped around?
Nucleosomes!
Each nucleosome (red balls in the cartoon) contains 8 histone proteins (two each of Histone 2A, 2B, 3 and 4). In addition,…
August 7, 2006
I haven't done this in a while:
Below the fold you'll find links to an interview with Alan Parker editor of Nature Genetics, Boltzmann and entropy, Big Biology, Tanzanian society (as seen through a medstudent from the west) and a note on affirmative action.
Hsien Hsien Lei of Genetics and Health…
August 6, 2006
What a nice day. Sitting on the esplanade, reading Colin McGinn's The Making of a Philosopher (a personal memoir + thoughts on 20th century philosophy). And I come across this:
Nowadays psychology has pretty much the shape that Chomsky advocated, and it is hard to remember the time when behaviorism…
August 5, 2006
You can find almost anything on Youtube.
Here is a video from Nikon (maker of great microscopes) of mouse fibroblasts (connective tissue cells) dividing and migrating around a coverslip.
Ah, this is why I became a cell biologist. Look at those guys go! (And to think that some would call them bags…
August 5, 2006
Well two weeks ago in Science, two reports came out about yet another species of small RNA ... rasiRNA ... uhm ... piRNA (OK they haven't harmonized their nomenclature yet).
So here is a brief review of the types of RNA:
- mRNA (messenger RNA). These are the RNAs that encode polypeptide chains.
-…
August 4, 2006
My baymate and I started a little discussion about lab fashion. Why? Well I'm a pretty ardent wearer of sandals, I'll wear them until late fall if I have to. I'll wear them with jeans too. But under no circumstances will I wear sandals with socks.
We then listed all the faculty who combine these…
August 4, 2006
OK here is this weeks aerial photo:
Click here for a larger version
and the hint:
Where we came from
(But our cousin was found in a cardboard box)
As usual leave your guesses in the comment section (or if you don't want to ruin it for others email me, I'll post emailed answers over the weekend) .
August 3, 2006
Another "We support the postdocs" editorial at Nature Cell Biology:
The days when one could imagine starting a laboratory following a short postdoctoral position, or even with no postdoctoral training at all, are long gone. Nowadays, extensive postdoctoral training is essential not only if you are…