Okay OpenOffice fans, show me what you can do.
Earlier this week, I wrote about my challenges with a bug in Microsoft Excel that only appears on Windows computers. Since I use a Mac, I didn't know about the bug when I wrote the assignment and I only found out about it after all but one of my students turned in assignment results with nonsensical pie graphs.
So, I asked what other instructors do with software that behaves differently on different computing platforms. I never did hear from any other instructors, but I did hear from lots of Linux fans. And, lots of other people kindly…
classroom activities
Here's a fun puzzler for you to figure out.
The blast graph is here:
The table with scores is here, click the table to see a bigger image:
And here is the puzzling part: Why is the total score so high?
If you want to repeat this for yourself, go here.
You can use this sequence as a query (it's the same one that I used).
>301.ab1
CTAGCTCTTGGGTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCCGATGGAG
GGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGTGGGGGA
CCTTCGGGCCTCACACCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGG
CTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGA…
Do different kinds of biomes (forest vs. creek) support different kinds of bacteria?
Or do we find the same amounts of each genus wherever we look?
Those are the questions that we'll answer in this last video. We're going to use pivot tables and count all the genera that live in each biome. Then, we'll make pie graphs so that we can have a visual picture of which bacteria live in each environment.
The parts of this series are:
I. Downloading the data from iFinch and preparing it for analysis. (this is the video below) (We split the data from one column into three).
II. Cleaning up the data…
This is third video in our series on analyzing the DNA sequences that came from bacteria on the JHU campus.
In this video, we use a pivot table to count all the different types of bacteria that students found in 2004 and we make a pie graph to visualize the different numbers of each genus.
The parts of this series are:
I. Downloading the data from iFinch and preparing it for analysis. (this is the video below) (We split the data from one column into three).
II. Cleaning up the data
III. Counting all the bacteria
IV. Counting the bacteria by biome
Part III. Pivot tables from Sandra Porter on…
What do you do after you've used DNA sequencing to identify the bacteria, viruses, or other organisms in the environment?
What's the next step?
This four part video series covers those next steps. In this part, we learn that a surprisingly large portion of bioinformatics, or any type of informatics is concerned with fixing data entry errors and spelling mistakes.
The parts of this series are:
I. Downloading the data from iFinch and preparing it for analysis. (this is the video below) (We split the data from one column into three).
II. Cleaning up the data
III. Counting all the bacteria…
For the past few years, I've been collaborating with a friend, Dr. Rebecca Pearlman, who teaches introductory biology at the Johns Hopkins University. Her students isolate bacteria from different environments on campus, use PCR to amplify the 16S ribosomal RNA genes, send the samples to the JHU core lab for sequencing, and use blastn to identify what they found.
Every year, I collect the data from her students' experiments. Then, in the bioinformatics classes I teach, we work with the chromatograms and other data to see what we can find.
This is the first part of a four part video series…
You can get a jump on the Darwin Day festivities.
Once again the Alliance for Science is sponsoring an essay contest for Darwin Day. If you download their suggestions for good essay writing, you can get your essay done over winter break and have a good crack at winning on those cash prizes!
The Alliance for Science is pleased to announce our second annual National High School Essay Contest. We invite interested students to submit essays of up to 1,000 words on one of two topics -- Climate and Evolution or Agriculture and Evolution. Click on the topic names for some possible ideas to explore…
This is a fun puzzle. The pink molecule is a protein and the other molecule is a nucleic acid.
If I gave you the amino acid sequence of this protein, or the nucleotide sequence of this nucleic acid, what is the probability of finding a similar sequence in a different species (picked at random)?
A. High
B. Medium
C. Low
D. It depends on the database that you're searching.
You can have more than one answer.
Now, here's the hard part. Explain why you think your answer is correct.
As many of you know, I'm a big fan of do-it-yourself biology. Digital biology, the field that I write about, is particularly well-suited to this kind of fun and exploration.
Last week, I wrote some instructions for making a phylogenetic tree from mitochondrial genomes. This week, we'll continue our analysis.
I wrote this activity, in part, because of this awful handout that my oldest daughter brought home last year. She presented me with an overly photocopied paper that showed several protein sequences from cytochrome C in several creatures. She said she was supposed count the…
DNA sequence traces are often used in cases where:
We want to identify the source of the nucleic acid.
We want to detect drug-resistant variants of human immune deficiency virus.
We want to know which base is located at which position, especially where we might be able to diagnose a human disease or determine the best dose of a therapeutic drug.
In the future, these assays will likely rely more on automation. Currently, (at least outside of genome centers) many of these results are assessed by human technicians in clinical research labs, or DNA testing companies, who review these data by…
Last year I wrote about an experiment where I compared a human mitochondrial DNA sequence to primate sequences in the GenBank. Since I wanted to know about the differences between humans, gorillas, and chimps, I used the Entrez query 'Great Apes' to limit my search to a set of sequences in the PopSet database that contained gorillas, bonobos, chimps, and human DNA.
A week ago, I tried to repeat this experiment and...
It didn't work.
All I saw were human mitochondrial sequences. I know the other sequences match, but I didn't see them since there are so many human sequences that…
Reposted from Halloween 2006.
Since Ben shared his family's taxonomy of candy types, and it's Friday, after all, I thought I'd share some of things that we do with candy around our house and describe some fun things that you can do with candy at home.
Materials and methods. First, you need some candy. My husband and I used to get our candy fix from our kids, but only one of our children goes trick or treating these days. She's good, though. She works the blocks like a political volunteer a week before the election, hitting all of her friends' houses and the commercial district besides…
Metagenomics is a field where people interrogate the living world by isolating and sequencing nucleic acids. Since all living things have DNA, and viruses have either DNA or RNA, we can identify who's around by looking at bits of their genome.
Researchers are using this approach to find the culprit that's killing the honeybees. We're also trying to find out who else shares our bodies, and lives in our skin, in our stomachs, and other places where the sun doesn't shine. Craig Venter used metagenomics when he sailed around the world and sequenced DNA samples from the Sargasso Seas.
In this…
The simple fact is this: some DNA sequences are more believable than others.
The problem is, that many students and researchers never see any of the metrics that we use for evaluating whether a sequence is "good" and whether a sequence is "bad."
All they see are the base calls and sequences: ATAGATAGACGAGTAG, without any supporting information to help them evaluate if the sequence is correct. If DNA sequencing and personalized genetic testing are to become commonplace, the practice of ignoring data quality is (in my opinion) simply unacceptable.
So, for awhile anyway, I'm making a…
We have lots of DNA samples from bacteria that were isolated from dirt. Now it's time to our own metagenomics project and figure out what they are. Our class project is on a much smaller scale than the honeybee metagenomics project that I wrote about yesterday, but we're using many of the same principles.
The general process is this:
1. We sort the chromatogram data to identify good data and separate it from bad data. Informatics can help you determine if data is good, and measure how good it is, but it cannot turn bad data into good data. And, there's no point in wasting time with…
Would you like to have some fun playing with chromatograms and helping our class identify bacteria in the dirt?
This quarter, my bioinformatics class, at Shoreline Community College, will be working with chromatograms that were obtained by students at Johns Hopkins University, and graciously made available by Dr. Rebecca Pearlman. (See see "Sequencing the campus at the Johns Hopkins University" for more background.)
We are going to do a bit of metagenomics by using FinchTV and blastn to identify the soil bacteria that were sampled from different biomes and then use an SQL query that I…
Welcome Bio256 students!
This quarter, we're going to do some very cool things. We are going to use bioinformatics resources and tools to investigate some biological questions. My goal, is for you to remember that these resources exist and hopefully, be able to use them when you're out working in the biotech world. I don't believe that bioinformatics is a subject that you can really grasp without getting your fingers dirty. So, this course will include a lot of hands-on work.
My friend and collaborator at Johns Hopkins University has given me data sets from the past three years and we…
Two protein structures from an avian influenza virus are shown below. One form of the protein makes influenza virus resistant to Oseltamivir (Tamiflu®)
Don't worry, these proteins aren't from H5N1, but they do come from a related influenza virus that also infects birds.
technorati tags: molecular models, protein structures, influenza, bioinformatics, Cn3D
One protein structure is from a strain that is sensitive to an anti-viral drug called "Tamiflu®". The other structure is from the same virus, except there's a slight difference. A single base change in the viral RNA changed the codon that…
I began this series last week with a question about a DNA sequence that was published and reported to be one the first beta-lactamases to be found in Streptococcus pneumoniae. Mike has a great post about one of problems with this paper.
I think the data themselves are awfully suspicious.
So, last week I suggested that you, dear readers, go and find out why. I gave you a link to the abstract and a place to get started.
Perhaps that was too hard.
Sigh.
Okay, here's a little more help and another clue.
I highlighted the accession numbers. Post your guesses in the comments.
Charles Darwin was so fascinated by beetles he paid people to help him build his collection. The Coleopterists Society and the Smithsonian Institute want to help kids explore the wonders of beetles, too.
They're providing grants for kids, in grades 7-12 to work on beetle biology.
Applications are due by November 15, 2007.
The Coleopterists Society, an international organization of professionals and hobbyists interested in the study of beetles, has established a program to recognize young people studying beetles.
The Society has pledged to provide up to $300 each year for the Youth…