fun
clock | May 9, 2010...perhaps you and thousands of your friends can all simultaneously walk down the street wearing one of these:
[yes, sales will help feed my family, so there is my Conflict Of Interest statement for posting this here]
cagapakis | May 7, 2010I've been busily rubbing all sorts of things on bacterial growth plates after all the great suggestions I got yesterday. I want to present the data from the first big experiment suggested by JerryM, who wondered what kind of bacteria would be present on my hands immediately after washing them and then every thirty minutes after that until the next washing. My hypothesis was that there would be a small number of colonies on the plate I touched right after washing, and then steadily growing in number over time. I thought this would especially be true considering that I spend most of my time…
cagapakis | May 6, 2010Commenter JohnV asked me whether I had let any of my silkworms crawl on an LB plate (what microbiologists use to grow colonies of bacteria) to see what kind of bacteria is living on them in case I ever suffer from catastrophic experiment contamination. I hadn't thought of what kind of bacteria could be living on my silkworms (we are thinking about what kind of bacteria live in their digestive systems that help them digest leaves) so I tried it out! I let one of my wormies crawl on a plate, and I touched one with my relatively clean fingers as a pseudo-control.
I let the plates incubate at 37…
cagapakis | May 4, 2010So I had this great post planned about the Boston aquapocalypse but by the time I managed to get some water samples to the lab they had started heavily chlorinating the water and no bacteria were left! Since negative results don't make for good blog posts, please enjoy this video of my silkworms dancing to Flo Rida's Right Round instead.
awild | May 3, 2010What's this?
2 points for naming the structure, 4 for family, and 4 for genus/species.
The cumulative points winner for the month of May will win either 1) any 8x10 print from my insect photo galleries, or 2) a guest blog post on the (safe-for-work) topic of their choosing.
awild | May 2, 2010
How did they catch this footage of an ANTi-pesticide protest? Here's a peek behind the scenes.
cagapakis | April 27, 2010Silks are incredible protein fibers produced by many different species of insects. Besides their use in making versatile textiles, silks are currently used in many different medical and engineering applications, from sutures to tissue engineering scaffolds to flexible electrode brain implants. Since I love fabrics and I'm interested in what biological engineers can do with biomaterials, I recently started working on a fun side project to raise and engineer silkworms, the animals used in industrial silk production around the world. We're having a lot of fun learning about silk and how to raise…
awild | April 27, 2010I apologize for the slow blogging this weekend. We took a little road trip up to beautiful Madison, Wisconsin and were too busy with bratwurst, cheese, beer, and roller derby to bother with the internet.
Atta cephalotes in the fungus garden
The University of Wisconsin is home to Cameron Currie, whose lab is at the cutting edge of insect-fungus-microbe evolutionary biology. Cameron is one of the people who first realized that the classic ant/fungus mutualism was more complex than just the insect and the fungus, involving all sorts of microbes, including some that live on the ants' exoskeleton…
awild | April 26, 2010
This week we delve into the genes of the mystery organism. Here's a short snippet of DNA:
ATGTCGCGTATCATGGAAAAGGAAAACATCACCGAAAATCTGGAAAAGATTTCCATCAAGAATGCTCGTA
5 points for the first person to pick the genus and species, and 5 points to the first person who can explain why this particular gene was targeted for study.
I'll post the answer tomorrow. Since we've reached the end of the month, I'll tally all the points from the preceding mysteries and announce the March/April mystery winner, who is entitled to either 1) any 8 x 10 print from my photo galleries, or 2) a guest blog slot on any (…
awild | April 21, 2010...just for you.
Cimex lectularius, the common Bed Bug
More photos from this series are posted here.
photo details:Canon EOS 50D cameraCanon MP-E 65mm 1-5x macro lensISO 100, f/13, 1/250sec
awild | April 21, 2010What happens if you score bug blogs for various characters and crunch them through a phylogenetic analysis?
Morgan Jackson investigates:
Although Morgan's exercise was tongue-in-cheek, he did uncover a pattern worthy of further exploration:
The last thing I want to comment on is the huge skew between male and female insect bloggers. Of the 58 blogs where I could determine the author's sex, only 28% of them were written solely by women. Even more concerning perhaps is that 38% of these women bloggers choose to remain anonymous, while not a single male blogger chose to stay private! With…
cagapakis | April 20, 2010Light interacts with and controls biological systems in diverse and fascinating ways. Our eyes are made up of thousands of cells that respond to light, sending signals to our brain as light in different colors and shapes moves across them. Photosynthetic cells are full of receptors that can sense and respond to many wavelengths of light, allowing cells to absorb light for photosynthesis, but also to move towards areas of more sunlight and know when the seasons are changing. Synthetic biology takes these light-responsive systems as parts that can be recombined, shuffled and integrated into…
clock | April 20, 2010
[Hat-tip: "If you want to understand the future...don't pay attention to how technology is changing, pay attention to how childhood is changing."]
clock | April 20, 2010We bought a couple of these recently and use them for all our grocery shopping. They are environmentally friendly, strong chico bags, tiny when wrapped up (and easy to wrap up) and large when opened up:
Conflict of Interest: this is Bride of Coturnix's store (look around for other items). Every item sold puts money in our joint account. Which is good for me as I am owing tons in taxes.....
awild | April 19, 2010Tonight's mystery* takes us down into the magical world of scanning electron microscopy.
Five points for picking the organism and five for picking the structure. As usual, only the first correct answer in each category collects the points.
The cumulative points winner for the month of April gets to choose either 1) any 8x10 print from my photo galleries, or 2) a slot as a Myrmecos guest blogger on a safe-for-work topic of their choosing.
*Image by the lovely Jo-anne Holley
clock | April 19, 2010Shy about openly carrying condoms around your pocketbook? Well, hide them in a tasteful little case - a variety of styles, including, for those with a sense of humor and fun, these Kitty cases, pre-packaged with two condoms each:
Conflict of Interest: this is Bride of Coturnix's store (look around for other items). Every item sold puts money in our joint account. Which is good for me as I am owing tons in taxes.....
awild | April 18, 2010If ants were to drop acid I'm not sure what they'd experience. But this entrancing short film by Jörg Brönnimann is as good a guess as any:
ant-views from Jörg Brönnimann on Vimeo.
clock | April 17, 2010
I wonder how much more (and more accurate) detail this guy would get when sober. And how much less most other people would be able to say when sober....