awild | April 13, 2010The winners of the NCSU insect blog Hexapod Haiku Challenge have been announced. Here's the best in show:
Major, Undeclared
Silverfish, tell me,
Darwin and Dostoevsky,
do they taste the same?
-Martha Love
Gastonia, NC
Ha! I love it.
awild | April 12, 2010For a second time, that is. Some of you may remember me from Photo Synthesis, where I guest blogged for a bit a year ago. I am happy to be invited back to the borg!
Myrmecos is not a new blog. Rather, we have been over at Wordpress since 2007. I say "we", because the blog has evolved to become more of a community. Myrmecologists (= ant scientists) smarter than I hang out in the comments and submit guest posts, and there's a gang of top-notch nature bloggers over at Wordpress carrying on a stream of apparently continuous conversation across blogs of which Myrmecos is but one little part. Kind…
awild | April 12, 2010[note: this and all preceding entries are reposted from myrmecos.wordpress.com; guesses for this Monday Night Mystery are also lodged here.]
What in the world is this strange creature?
The point breakdown* will be as follows:
2 points for order
2 points for family
2 points for genus
2 points for species
2 points for describing the behavior
As in past weeks, you have to be first in each category.
*What are Myrmecos points good for? The cumulative winner at the end of the month gets to choose either 1)any 8x10 print from alexanderwild.com, or 2) a guest blog post on a topic of their choosing.
awild | April 12, 2010
A few days ago I posted a photo of a Prenolepis ant queen. It's a decent photo, in focus and properly exposed. But probably not anything I'd print out and hang on the wall.
Check out the monochrome version above, though (click on it to enlarge). I don't often put my images through such severe levels adjustments, but this one works rather well. I prefer it to the original.
awild | April 9, 2010
Penthe pimelia (Tetratomidae)Illinois, USA
A couple years back I was working on the Beetle Tree of Life project as a molecular phylogeneticist. My main responsibility was to gather DNA sequence data for several hundred beetles distributed across the spectrum of Coleopteran diversity.
As I'm not a Coleopterist, I spent most of my time lost in a befuddled daze of incomprehensible taxonomy. There are so many beetles. The larger families each hold more species than all of the vertebrates combined. Think about all the mammals and birds you know- the warblers, the polar bears, the shrews, the…
awild | April 7, 2010Wasmannia auropunctata - little fire ants Buenos Aires, Argentina
One of the world's worst invaders, the little fire ants have spread from the new world tropics to warmer regions around the globe, becoming especially problematic on oceanic islands. The ants above, though, are from an innocuous native population in northern Argentina. They arrived at a cookie bait at the Costanera Sur reserve, barely noticeable specks of orange just over a millimeter long.
Wasmannia has a painful sting for such a small insect, and the ants do this annoying thing where they'll wander around on your body for an…
awild | April 7, 2010If you've been following the Taxonomy Fail and subsequent Myrmecology Win, you'll know that the real Fail was my own. That blurry mash of legs and cuticle is indeed an ant, and I missed it.
That I failed to discern an ant in the original image doesn't bother me. After all, the photo was the equivalent of an amber inkblot, with key bits out of focus, and the paper itself provided no support for the identification. I stand by my comments about the burden of proof lying with the authors- the paper did not adequately justify its conclusions. Partly, this is less the fault of the authors than the…
awild | April 6, 2010Plega sp. (Mantispidae)
Who was the source of Monday's DNA? As many of you discerned from the online Genbank database, the sequence came from Plega dactylota, a Neuropteran insect in the family Mantispidae.
10 points to Aaron Hardin, who guessed it first.
For future reference, these genetic puzzles are only slightly more complicated than a Google search. Go to NCBI's BLAST page, select "nucleotide blast" (because we have nucleotide data), click the box for "others" to get you out of the human genome, enter the sequence in the search box, and click the "BLAST" button. Any significant matches…
awild | April 6, 2010Well. Raising a holy hullabaloo on the internet pays dividends. Vincent Perrichot, one of the authors on the contested PNAS paper, has sent along another aspect of the mystery fossil:
Having trouble? I've arranged a Formica specimen to model the pose:
In the comments below, Vincent provides his perspective:
Well, sounds that the ant nature of our fossil is getting much controversy here! I understand that the photograph provided in our paper is not very clear, so I'd like to clarify things and try to convince everyone. First of all the photograph you are commenting on was published here…
awild | April 5, 2010
In a change of pace, tonight's mystery is for the bioinformaticians. Here's some DNA sequence:
ACGAAATCGGCGAGAAAGTCGCGCCCAGCGCCGCTGTTTACTCGATTCAGGAAGCCCTGGACGCCGCAGA
What sort of organism did it come from?
Ten points to the first person who can pick the genus.
awild | April 5, 2010Today's breaking news in Ant Science is this:
Newly discovered pieces of amber have given scientists a peek into the Africa of 95 million years ago, when flowering plants blossomed across Earth and the animal world scrambled to adapt.
Suspended in the stream of time were ancestors of modern spiders, wasps and ferns, but the prize is a wingless ant that challenges current notions about the origins of that globe-spanning insect family...Inside the Ethiopian amber is an ant that looks nothing like ants found in Cretaceous amber from France and Burma.
Wow- that's big news! I wonder what this…
awild | April 5, 2010[a guest post by myrmecologist Andrea Lucky]
Andrea & her intrepid field team in New Guinea
It was a dark and stormy night...
...actually, it was a dark and stormy morning. The dawn of the 7th day of ceaseless frigid rain to be precise, and I was reminiscing about the grand old days one week before when the sun emerged and for a glorious 10 minutes it was warm enough to splash some water on my arms, legs and neck and wipe away the accumulated grime that is synonymous with field work. I wondered if that lovely burst of sunshine would ever come again (no, it wouldn't), and every time I…
awild | April 4, 2010
Prenolepis imparis - winter ant (queen)
Urbana, Illinois
Photo details: Canon mp-e 65mm 1-5x macro lens on a Canon EOS 50D
ISO 100, f13, 1/250 sec, diffused flash
awild | April 3, 2010We're hosting a party for the roller derby girls, so I'm otherwise preoccupied today. Help yourself to some links, though:
Mark Moffett, the quintessential National Geographic bug photographer, has a new ant book.
Margaret Atwood (yes, that Margaret Atwood), reviews E. O. Wilson's novel.
Carl Zimmer suffers genome fatigue.
Mantis shrimp glow in the dark.
Who wants to help Tim Eisele identify his mystery ants?
awild | April 2, 2010Dendroides fire-colored beetle,
Illlinois
We in the Friday Beetle Department don't often turn our attention to immature beetles. But these Dendroides larvae are too striking to pass up.
Dendroides fire-colored beetles inhabit the flat, two-dimensional space under the bark of dead trees. The oddly compressed body helps this insect squeeze through tight spaces looking for food.
update: Identification updated, on closer examination of the urogomphi. I think everyone should spend more time examining urogomphi.
Photo details: Canon mp-e 65mm 1-5x macro lens on a Canon EOS 50D
ISO 100, f13, 1/…
awild | April 1, 2010
Myrmicocrypta camargoi Sosa-Calvo & Schultz 2010
Brazil
The world's ant fauna continues to yield new treasures. Myrmicocrypta camargoi, described in a new paper by Jeffrey Sosa-Calvo & Ted Schultz, is the largest species in this fungus-growing genus.
source: Sosa-Calvo, J., Schultz, T.R. 2010. Three Remarkable New Fungus-Growing Ant Species of the Genus Myrmicocrypta (Hymenoptera: Formicidae), with a Reassessment of the Characters That Define the Genus and Its Position within the Attini. Annals of the Entomological Society of America 103(2):181-195.
doi: 10.1603/AN09108
artwork by…
awild | March 31, 2010Leptomyrmex darlingtoni, Australia
A big day for ant evolution! The Ant Tree of Life research group (AToL) has published their dolichoderine phylogeny in the journal Systematic Biology.
Dolichoderines are one of the big ant subfamilies, comprising just under ten percent of the world's ant species. These are dominant, conspicuous ants noted for having ditched the heavy ancestral ant sting and armor in favor of speed, agility, and refined chemical weaponry. Most dolichoderines live in large colonies with extensive trail networks, and they fuel their frenetic lifestyle through copious…
awild | March 31, 2010Hippodamia sp. Ladybird beetle
Tucson, Arizona
Photo details: Canon 100mm f2.8 macro lens on a Canon EOS 20D
ISO 100, f4.5, 1/320 sec, ambient light